Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST329467
Clone ID OST329467
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST329467
Sequence
GCGCAGCTGTCTGAGCCCTCCCTNCTCTCTTGAATACCATCAATAAAGTTCGCTGCACCTT
Sequence Type mRNA
Unitrap ID UNI6920 UNI6921 UNI6922 UNI6923 UNI21469 UNI21470

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166349: 397556..397602 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078142 (AC147142.2-201) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25870103..25870149 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 61920159..61920205 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4836254..4836300 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071813 (AC117588.11)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49900116..49900162 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82473000..82473046 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021139 (Synj2bp) NM_025292 COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20234838..20234884 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078965 (OTTMUSG00000005300) NP_032110 predicted gene, OTTMUSG00000005300 Pseudogene [Source:MGI Symbol;Acc:MGI:3650751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75541259..75541305 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12113267..12113313 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079360 (AC158396.2-202) GAPDH Fragment [Source:UniProtKB/TrEMBL;Acc:Q2VWQ4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 33528124..33528170 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77929238..77929284 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83824194..83824240 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079501 (AC156283.6) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 79857320..79857366 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 13042254..13042300 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073212 (OTTMUSG00000017911) predicted gene, OTTMUSG00000017911 Pseudogene [Source:MGI Symbol;Acc:MGI:3709612]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57383646..57383692 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078696 (AL772328.13)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 61265602..61265648 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77439011..77439057 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11330478..11330524 45
NO GENE  

 
Come back to gene ENSMUSG00000078696


For any suggestions or comments, please send an email to unitrap@crg.es