Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST329399
Clone ID OST329399
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST329399
Sequence
GAACTGAGAATGGAATGACCTATGATGATGTGCATGTAAACTTCACTGGCGAAGAGTGGGCTTTGCTCANTCCTTCCCAN
AAGAGGCTCTACAAGGATGTAATGCTGGAAACCTACAGAAACCTCACTGCTATAGGNTGCAGTTGGGAAAACCCGTAATA
TTGAAGAATATTTTCAACTGTTCTATAAGATATGGAAGGCATGAAAGAAGTCATACTGGAGAAAAACCTTCTGTATATAC
TCAATGNAATAAAGCATTTGCATATCAGA
Sequence Type mRNA
Unitrap ID UNI21473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 48736799..48738331 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074166 (AW146154) NP_001028702 Putative uncharacterized proteinExpressed sequence AW146154MCG140425, isoform CRA_b ;; [Source:UniProtKB/TrEMBL;Acc:Q3TPQ7]

 
Come back to gene ENSMUSG00000074166


For any suggestions or comments, please send an email to unitrap@crg.es