Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST329348
Clone ID OST329348
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST329348
Sequence
GACTGAGAGCGTCCTAGCTGAACCATCAAGGTCTAATGGAAATATGGTTCGTCATTCTTCGTCTCCATATGTATTGTATC
CACCTGATAAGCCTTTCCTTAACAGTGATNTGAGACGCTCCCCAAATAAGCCCACATTTGCCTATCCGGAAAGCAACAGC
AGAGCCATATTTTCTGCTCTTAAGAATCTTCAAGATAAGATTCGACTGCCTGGAACTGGAAAGGATTCAGGCAGAAGAAA
GTGTGAAAACCTTGTCTAGGGAAACCATTGAGTACAAGAAAGTATTGGATGAACAGATCCAAGAGAGGGAGAACTCAAAG
AATGAAGAATCAAAGCACAATCAAGAACTGGCATCCCAGTTGGTAGCTGCAGAAAATAAATGTAATCTTCTAGAAAAACA
ATTGGAATACATGCGAAATATGATAAAGCATGCAGAAATGGAGAGGACATCTGTGTTAGAAAAGCAGGTTTCTCTAGAAA
GAGAACGGCAGCATGATCAAACCCATGTTCAGAGCCAGCTGGAAAAACTGGATCTTCTTGAACAGGAATACAACG
Sequence Type mRNA
Unitrap ID UNI21475

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13621361..13626129 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031922 (Cep57) NP_080941 centrosomal protein 57 Gene [Source:MGI Symbol;Acc:MGI:1915551]

 
Come back to gene ENSMUSG00000031922


For any suggestions or comments, please send an email to unitrap@crg.es