Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0663
Clone ID CC0663
Vector pGT0lxfT2
Project sanger

Sequence tag CC0663
Sequence
AAGATGCTGAGCAGGTTGATGAGCGGCAGCAGCAGGAGTCTGGAGCGCGAGTACAGCGGCACCGTGCGGCTGCTGGACGA
CAGCGAGTACACCTGCACCATCCAG
Sequence Type mRNA
Unitrap ID UNI4526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121632466..121632570 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es