Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST329091
Clone ID OST329091
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST329091
Sequence
GGTACTACTCCATGACTGANATCATNACGTNCACANCAACNGNCAAANACATGCCTTCGATGGCTATGAGGTGAACTGGA
CTGAGCAGCAGCAGACGGTGTCCTGTCTGCACACCCTGGNCTACCCCCTAGCCCAAGGGCAGGGTCTGCATGTGACCGGC
ATTTCCTGGAACTCGACAGGCTCTGTGCTGGCCTGTGCCTATGGTCGGCTAGATGATGGAGACTGGANTACACTCAAGTC
CTACGTNTGTACTTGGAACCTGGACCGCCAAGGCCTGAATCCCCANCNGCCATCANNAGTGGNGGAGGTGCCGAGTGCTG
NCATGTGCCTGGCCTTTCATCCCACACAGNCCTCCCACATTGCCGGGNGGCTGTATAGCGGGGAAGTGCCC
Sequence Type mRNA
Unitrap ID UNI21488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29888880..29893759 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039715 (Wdr34) NP_001008498 WD repeat domain 34 Gene [Source:MGI (curated);Acc:Wdr34-001]

 
Come back to gene ENSMUSG00000039715


For any suggestions or comments, please send an email to unitrap@crg.es