Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST329061
Clone ID OST329061
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST329061
Sequence
ACTGAGGGGTGAATGAGAGGGAGTACTGGAAGGAGTCAAACAAAGGGCACAGCTCCAGGGCCATGATGCTGTCCAGACCG
AAGCCTGGAGAGTCAGAGGTGGACCTGCTGCGCTTCCAGAGCCAGTTCCTTGAGGCTGGTGCAGCCCCGGCGGTGCAGCT
GGTGAAGGGGAGTAGGAGGCATGGTGATGCTCCTCCAGACCGGCTCCCACCGCAGGACCATCGGGATGTGGTGATGCTGG
ACAATCTCCCAGATTTGCCCCCAGCTCTGCTTCCCGCTCCTGCAAAAAGAGCAAGACCGAGCCCTGGTCGCCCCCTGCCT
CACGATGAAGACCCTGAAGAGAGGCTGAACAGGCATGATCAGCACATCACTGCTGTCTTGTCTAAGATTGTTGAACGAGA
TACAAGTTCAGTCACTGTGACTCTGCCTGTGCCCAGTGGTGTTGCTTTCCCGCCTGTGTTCCATCGCTCTCAGGAGAGAC
AGGTGAAACCAGCAGCATCTGGTAAAAGGAGCATCTTTGCCCAAGAGATTGCAGCAAGAAGGGTGTCAGGAGGATGCT
Sequence Type mRNA
Unitrap ID UNI21122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119605844..119609708 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es