Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST328871
Clone ID OST328871
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST328871
Sequence
TTGGTGGAGGGTTTTATGTGAAATCATTTTTAAAGTATTCACGAAAATTCTGTCCCAGCCACTCAAAGGTTCCTGACCTA
TCTGAAGTCATGGACTGGTGGGCCTGGCCCTGCAAGCNGTGAACAGCTGCTGAATTCTGCAAACANGGACTTGGCTCAGT
ATTTGATNGATGCCTTGATTTCCATTTCATGTATTTAATTTAATTTAATAAAATATAAGCATTAAAA
Sequence Type mRNA
Unitrap ID UNI16824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144420874..144421095 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074754 (Gm561) NM_001033297 gene model 561, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685407]

 
Come back to gene ENSMUSG00000074754


For any suggestions or comments, please send an email to unitrap@crg.es