Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST328561
Clone ID OST328561
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST328561
Sequence
TTGGAAAACTGCACATCTAGTTGGCTCCAAATTGTAAACCACAGGATGAGTATTCAGTGGGCATGAGAGATTGAGAACAT
CCTACCACACCATAAACCTTGGTGTAGATCACTTCCTTTTCTGTGGATTGAAGCCAGAGAGCACAATGAGTACAAGAAAT
CCTCAAAGAAAGCGGCGTGGTGGAACTGTGAATTCTAGACAAACCCAGAAGCGAACTCGGGAAACAACTTCGACCCCTGA
GGTTTCCTTGGAAACAGAACCCATAGAACTTGTGGAAACTGTTGGAGATGAAATTGTGGACCTCACCTGTGAATCTTTAG
AGCCCGTGGTTGTGGACCTGACTCACAATGACTCTGTTGTGATTGTTGAAGAAAGGAGAAGGCCAAGGAGAAATGGGAGG
AGGTTG
Sequence Type mRNA
Unitrap ID UNI20422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34685174..34692595 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029110 (Rnf4) NP_035408 ring finger protein 4 Gene [Source:MGI Symbol;Acc:MGI:1201691]

 
Come back to gene ENSMUSG00000029110


For any suggestions or comments, please send an email to unitrap@crg.es