Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1245
Clone ID GC1245
Cell line E14Tg2A.4
Vector pFlip2
Project tigem
Note NULL

Sequence tag GC1245
Sequence
TCGTGACCATTAGGGNATTTGAATTGAATGGACATCCAATACTCAAGAGAGCTAACATCCGGACTGTTGGCAAGTTGGTG
GCTCGATCCATAAGAGAAAGAAAAATGAGACAATTTTATAAAACATGAGAACTGGAATAAATTTTTCAGCACAGTGCTCC
ATTAAATAGTTGAACTTATCTCCTCAGAAATGCATATTAGTAATGAACACAGAATGATTTGCTATTGACAGGATAAAGGG
TGAAATCTTTGGATGTTGACAAGTTAGTTCATCATTGATAAGTAAGTTTGGATGAGCGGTCTTTATCTTCCTCATTAAAC
ATCTGCTAATCATGACACAAAAAAAAAAAAAAAAAAATTATTGTTTCT
Sequence Type mRNA
Unitrap ID UNI385

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 78508085..78508407 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031620 (1700007B14Rik) RIKEN cDNA 1700007B14 gene Gene [Source:MGI Symbol;Acc:MGI:1919081]

 
Come back to gene ENSMUSG00000031620


For any suggestions or comments, please send an email to unitrap@crg.es