Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST327393
Clone ID OST327393
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST327393
Sequence
GGGACATCCGGTAAGAAAGCAGNTGNCCAGCCATTTCAGAACACGTACCAGGTGTTGGCATGTGACCTTCAATGACACGA
GCGANCAGATTATCTNTGGNGGAATAGATAATGACATCAAGGNCTGGGACCTACGCCAAAACAAGTTAACCTACACCATG
AGANGCCATNCANACTCTGNAACATGGCCTGAGCTTGAGNTCTGAAGGCTCTTATCTNCTGTCCAATGCAATGGACAACA
CAGTTCGTGTCTGGGATGTCCGGCCATTTGCTCCCAAAGAGAGATGTGTGAAGATATTTCAAGGAAATGTCCACAACTTT
GAAAAGAACCTCCTGAGATGTTCCTGGTCTCCAGATGGAAGCAAGATAGCAGCTGGCTCAGCAGACAGGTTTGTGTACGT
GTGGGACACCACAAGCCGAAGGGTCCTGTACAAGCTGCCTGGTCACGCTGGCTCCATCAATGAAGTGGCTTTCCACCCCG
ACGAGCCCATCATCCTC
Sequence Type mRNA
Unitrap ID UNI21518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130055297..130065926 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074088 (Wdr57) NM_025645 WD repeat domain 57 (U5 snRNP specific) Gene [Source:MGI Symbol;Acc:MGI:1913835]

 
Come back to gene ENSMUSG00000074088


For any suggestions or comments, please send an email to unitrap@crg.es