Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0596
Clone ID AS0596
Vector pGT0lxr
Project sanger

Sequence tag AS0596
Sequence
CGACGAGAGCTCCGATGTCCCCCGGGAGTTAATGGAAAGCGTCAGGGATGTTATTGGCAGGAGGATCAAAATCTCAGTGA
AGAAGAAAGTGAAGTTGGAAGTGAAGGGCGACAGGGTGGAAAACAAAGTGCTGGTGCTCACATCATGCCGAGCTTTCCTC
CTGTCAGCACGCATCCCCAGCAAGCTCGAGTTAACCTTCAGTATACTAGAGATTCATGGAGTCATCTGCCACAAGCCAGC
C
Sequence Type mRNA
Unitrap ID UNI4536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24265488..24372464 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021338 (Lrrc16a) NM_026825 leucine rich repeat containing 16A Gene [Source:MGI (curated);Acc:Lrrc16a-001]

 
Come back to gene ENSMUSG00000021338


For any suggestions or comments, please send an email to unitrap@crg.es