Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST326785
Clone ID OST326785
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST326785
Sequence
CCATGAGCATTATATTGATATAAGTGTTTTTTCGTATTCCATTTACGTGTTTTTAATAAAGTTGCATGCTAAACACAAA
Sequence Type mRNA
Unitrap ID UNI21531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 132281787..132281861 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072969 (Armcx5) NP_001009575 armadillo repeat containing, X-linked 5 Gene [Source:MGI (curated);Acc:Armcx5-001]

 
Come back to gene ENSMUSG00000072969


For any suggestions or comments, please send an email to unitrap@crg.es