Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0683
Clone ID AN0683
Vector pGT0lxr
Project sanger

Sequence tag AN0683
Sequence
GGGATAGGTTACGTTGGTGTAGATGGGCGCCCCAGTACCCCAGTGCTTTTCCATCCTCACTCCCGCCTGTCAGCCTTCTA
CCCCATGAGAAAGACCAGT
Sequence Type mRNA
Unitrap ID UNI3389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22336647..22336720 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es