Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST326512
Clone ID OST326512
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST326512
Sequence
GCCAAAGTTTACCTTCTATGATGGGCCTCCCTTTGCTACTGGACTGCCTCACTATGGACACATACCTTGCCTGGGACAAT
CAAAGATATCGTTACGAGATACGCTCACCAGAGCGGGTTTCACGTTGACAGAAGATTCGGGTGGGACTGTCACGGCTTAC
CTGTGGAGTACGAAATCGATANGACACTGGGCATCAAAGGCCCGGAGGATG
Sequence Type mRNA
Unitrap ID UNI16705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49783526..49783938 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es