Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST326150
Clone ID OST326150
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST326150
Sequence
GAGCCTGAAGAATAATGTAGNGACAGCATCTATCAAGAGCTAAGAAGAGACTCCCGCATTTCTCTGNGGTAGAGAACTGC
TCACCAACCAAAGGAGGATCCTTTCTCAAGCAATGAACATTTCTTACAAGGATTCACAGATTAACACGTGACCAGTATTG
ATTTTTGAAAGTAAATAAGATTTCCTTTTCTTCTTCTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24426349..25170412 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]

 
Come back to gene ENSMUSG00000037492


For any suggestions or comments, please send an email to unitrap@crg.es