Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0603
Clone ID AM0603
Vector pGT0lxr
Project sanger

Sequence tag AM0603
Sequence
TCATGGTGGACTCGTCTGACCGGCTAAGGCTGCCTTGGGCTCGGCAGGAGCTGCAGAAACTGTTGGACAGGGATCCGGAT
CTTCCT
Sequence Type mRNA
Unitrap ID UNI4408

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54680220..54680305 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025870 (Arl10) NM_019968 ADP-ribosylation factor-like 10 Gene [Source:MGI Symbol;Acc:MGI:1930788]

 
Come back to gene ENSMUSG00000025870


For any suggestions or comments, please send an email to unitrap@crg.es