Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST326043
Clone ID OST326043
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST326043
Sequence
GAGGTTCATTTGGGAAGANCATACAAGTGAAGACCATTTTCAAACTTCTAGAAGTCATGGAAGGCATGAAAGAAGTTGTT
CTGCAGAGCAACCCTCTGAGTTTATTCACTGTGGTAAAGCCTTTGCAAATGAGAGTGGTAGTCAAAGGCATCAAATAAAA
CATACTGGAGAGAAACA
Sequence Type mRNA
Unitrap ID UNI21560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177050200..177050315 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078869 (OTTMUSG00000016577) predicted gene, OTTMUSG00000016577 Gene [Source:MGI Symbol;Acc:MGI:3649811]

 
Come back to gene ENSMUSG00000078869


For any suggestions or comments, please send an email to unitrap@crg.es