Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST325531
Clone ID OST325531
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST325531
Sequence
ACTGAGGACTGAATTTACTCTTAAAGAAACTATGTCCTCTGGAGGTGCTGAAGATGACATCCCACAGGGAGAGAGGAAGA
CAGTTACAGATTTTTGTTATCTTTTGGATAAATCCAAGCAACTGTTCAATGGCTTAAGAGATTTGCCTCAGTATGGACAG
AAGCAGTGGCAGTCCTACTTNGGAAGAACTTTTGATGTTTACACCAAACTCTGGAAATTCCAGCAGCAGCATCGACAAGT
CTTGGATAATCGGTATGGCTTGAAGCGGNGGCAAATAGGGGAAATCGNTTNCAAGATCGGGCAGCCTGTATTACCACTAT
TATTTACGAACTTCTGAGACCAGTTATCTGAATGAGGCTTTCTCCTTCTACTCTGCAATCAGACAGAGATCATACTACTC
TCAAGTCAATAAAGAGGACAGGCCTGAGTTGGTTGTTAANAAACTCCGATACTACNCNAGATTTATAGTAGNTNGCCTTC
TTCTTAACAAAATGGACGTTGTGAAAGACCTGGTAAAGGAATTGTCNGACCCTCTGATGGAGGGCTT
Sequence Type mRNA
Unitrap ID UNI20037

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38963826..38988608 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035236 (A930041I02Rik) NM_178778 RIKEN cDNA A930041I02 gene Gene [Source:MGI Symbol;Acc:MGI:2443716]

 
Come back to gene ENSMUSG00000035236


For any suggestions or comments, please send an email to unitrap@crg.es