Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST325422
Clone ID OST325422
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST325422
Sequence
GACTGAGCTAAAGTTATGAAGTTTCAAGNATGAATTGGAATCTGGAAAGAGACCTAAAAAACCAGGCCAAAGCTTCCAGG
AACAAGTAGAGCACTACAGGGATAAACTGCTGCAGCGGGAGAAGGAAAAAGAATTAGAAAGAGAACGAGAAAGAGACAAA
AAAGATAAAGAAAAATTGGAATCTCGATCCAAAGACAAGAAGGAAAAGGATGAATGTACTCCAACAAGAAAAGAAAGGAA
GAGACGACATAGTACCTCCCCCAGCCCTTCTCGAAGTAGCAGTGGTCGGCGTGTGAAATCCCCATCACCCAAATCAGAGC
GCTCTGAACGGTCAGAAAGGTCTCACAAAGAAAGTTCTCGGTCCAGATCCTCTCACAAAGACTCTCCTAGAGACGCTAGC
AAAAAAGCCAAAAGGTCGCCGTCTGGTTCAAGGACACCTAAAAGGTCTAGGCGCTCTCGCTCTAGGTCCCCTAAGAAATC
AGGGAAGAAATCCAGATCTCAGTCCCGGTCTCCACACAGGTCTCATAAAAAGTCCCT
Sequence Type mRNA
Unitrap ID UNI4127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 95361843..95367077 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032407 (2610101N10Rik) NM_026476 RIKEN cDNA 2610101N10 gene Gene [Source:MGI Symbol;Acc:MGI:1915208]

 
Come back to gene ENSMUSG00000032407


For any suggestions or comments, please send an email to unitrap@crg.es