Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST324707
Clone ID OST324707
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST324707
Sequence
TTCTGGCAAAGTAGAAGGTGACACTTGTTCCCTTAATGAGTTCAGCATAACTGGATCCACATATGCACCAATTGGAGAAG
TGCAAAAGGATGATAAGCCAGTGAAGTGCCATCAGTATGACGGGCTTGTAGAGTTAGCCACCATCTGTGCTCTGTGTAAT
GACTCTGCTTTGGATTAAATGGACAGAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122916839..122917797 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

 
Come back to gene ENSMUSG00000029467


For any suggestions or comments, please send an email to unitrap@crg.es