Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0202
Clone ID AG0202
Vector pGT0lxr
Project sanger

Sequence tag AG0202
Sequence
CAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGAT
TCGACTTAGACTTGACCTATATTTATCCAAATATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGTGTATACAGG
AACAATATTGATGATGTAGTAAG
Sequence Type mRNA
Unitrap ID UNI435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32832916..32850589 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es