Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST323836
Clone ID OST323836
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST323836
Sequence
CAGTAAAAGGCAAGTATGAATCATTACCNATAGATATAGTTCTTCAGACACTTCTGGCCTTNGCAGTTACCTGTTATGGC
ATAGTTCATATCGCAGGGGAGTNCANAGACATGGATGCCACATTCAGAATTAAAGAATAAGACATTTGATACCTTAAGGA
ATCACCCATNTTTTNATGNGTNCAACCATNGNGGTCGAGTGCTGTTCCGGCCTTCAGATGCAACANATNCTTCAAACCTA
NATGCATNGTCCTCTAATACATCGTTGAAGTTACTGAAAGTTTGACTCACTGCGCCGTTAAGCTTTTTACAAATTAAATA
ACAGGACAGACACAGAATTGAGTATTGGAGTTTGGGGTGTAAAACACTCCCCCCAAGATCAGTATTTATATTGCTATTTC
AGAGCTAGTTAAACTAATCTATGGGCCCTTGNTTATATATTATCGATCCGATCAAATGGAGTATGAATTAT
Sequence Type mRNA
Unitrap ID UNI21616

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 53842151..53844377 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061273 (Tmem32) NM_146234 transmembrane protein 32 Gene [Source:MGI (curated);Acc:Tmem32-001]

 
Come back to gene ENSMUSG00000061273


For any suggestions or comments, please send an email to unitrap@crg.es