Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST323620
Clone ID OST323620
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST323620
Sequence
GACTGAGGAAGCAGTTCAGTTCTTTAATGTGACGACGCTCCAGAAGGAACTGTACGACTTCGCTCAGGAACACCTAATGG
ATGACGATGAGGGAGAGGTTGTGGAGTATGTGGACGACTTGTTGGAGACGGAAGAGTCTGCCTAGTCCACAGGGGCTAAG
GAACCTCTCTTCCGAGTTCCTCTTTCTTCAAGTGCCTGGGTTGTTGATACCTCACAGCCTTTTCTTCTTAAAGTAAGAAG
GAAGCCACCATCTCTCCCTACCAAGGTCAAGCCTGACTTCCCCTTGTTCACACTCAGTATTCACGCTTGTCTTCATGGTT
ACACGTCTTCATGCCTGTCTTTCCCTTCACACATGTGTTCCCGTCATCTAGTCTGTCCTCCTCAAAGTCACGTTCGTCTC
CCCTCTGATCCCATGTGTCTCCCCCATGTTCAGAAAGACAGTCTTCTGTGGTCTGCTTTCTCATCCCTGAAGAAAAATCA
GTATTATTTTTTAAGTAAGAAAAACACTAAAAGATGATAAATATATTTGG
Sequence Type mRNA
Unitrap ID UNI21624

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114284262..114287243 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032431 (Crtap) NM_019922 cartilage associated protein Gene [Source:MGI Symbol;Acc:MGI:1891221]

 
Come back to gene ENSMUSG00000032431


For any suggestions or comments, please send an email to unitrap@crg.es