Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST323510
Clone ID OST323510
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST323510
Sequence
GACTGAGGGTAAAGCCCCAAAGGCTGTCATCAGCATCAAGGACTTAAACGCCACCTTCCAGACAGAGAAGATAGGACATC
CCCACGGGCTGCAGATCACCTACAGGAAAGAGGGCCACACCAGGAACCTGTTTGTTTATCATGACAGTGGGAAGGAGATA
GGGCNTNGGTTCANTGCTCTNCGTGCAGCCCGCCTGCAATACCTGAAATTGGCCTTTCCTGATCTCCCAGAGTCTGAGCT
CGTGCCTCTCATCACCAGGAACTACCTCAAACAAGGCTTCATGGAGAAGACTGGTCCAAAGCATAGAGAACCCTTCAAGA
AAAGATGGTTTGCCTTGGATCCGCAGGAACGGAGGCTGCTCTATTATAAGAACCCCCTGGATGCTTTTGAGCTGGGCCAG
GTTTTTCTGGGAAGCAATGAGCAGGGATATGAAGTATGGGAAGATCTGCCCAAGGGCATCCGAGGGAACCGCTGGAAGGC
TGGACTTACCGTCATCACTCCGGAGCGGAAATTCAT
Sequence Type mRNA
Unitrap ID UNI21628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79979173..79990684 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es