Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0688
Clone ID AE0688
Vector pGT0lxr
Project sanger

Sequence tag AE0688
Sequence
AGTAGTCCAGAAATTGTTTACTCCATATACTGAAATCGAAGCAGAAAGTGAACAGGGTGACAGGCCAGGAATTCTATGGG
C
Sequence Type mRNA
Unitrap ID UNI3695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 110161069..110166714 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025531 (Chm) NM_018818 choroidermia Gene [Source:MGI (curated);Acc:Chm-001]

 
Come back to gene ENSMUSG00000025531


For any suggestions or comments, please send an email to unitrap@crg.es