Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0773
Clone ID AD0773
Vector pGT0lxr
Project sanger

Sequence tag AD0773
Sequence
AGAAGATGCAGAGGATGGCCCACCAGAATTGTTGTTTATTCATGGTGGTCACACTGCCAAGATATCTGACTTCTCCTGGA
ATCCCAATGAGCCTTGGGTGATTTGTTCTGTATCAGAAGACAATATCATGCAAGTGTGGCAGATG
Sequence Type mRNA
Unitrap ID UNI4245

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 128994892..128995139 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057236 (Rbbp4) NM_009030 retinoblastoma binding protein 4 Gene [Source:MGI (curated);Acc:Rbbp4-001]

 
Come back to gene ENSMUSG00000057236


For any suggestions or comments, please send an email to unitrap@crg.es