Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0458
Clone ID AD0458
Vector pGT0lxr
Project sanger

Sequence tag AD0458
Sequence
CCCAGTCTCCCAAGCAGCCAAAGGAACCCCTCTCCCACCGCTTCAACGAGTTCATGACCTCCAAACCCAAAATCCACTGC
TTCCGGAGCCTAAAGCGTGGG
Sequence Type mRNA
Unitrap ID UNI4567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30908505..30908605 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es