Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0300
Clone ID AD0300
Vector pGT0lxr
Project sanger

Sequence tag AD0300
Sequence
CAAGGAGATAAAAGGCCTGAAGGTGGAAGTGACCCACTGTGGACAGATGAAGAGGAAATACCGCGTGTGTAATGTTACCC
GCCGCCGTGCTAGCCATCAGAGGTTCCCCTTGCAGCTGGAGAGTGGACAGACTGTGGAGTGCACTGGGGCACAGTATTTC
AAGCAGAAATATAACCTTCAGCTCAAGTATCCTCACCTGCCCTGCCTACAAGTTGGGCAAGAACAGAAGCATACCTATTT
GCCCCTGGAG
Sequence Type mRNA
Unitrap ID UNI4568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126136353..126137113 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es