Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0296
Clone ID AD0296
Vector pGT0lxr
Project sanger

Sequence tag AD0296
Sequence
ATGTTATTCGATTTAATACGCCATTCTGCTCTTTCTTGTAGCTCGATTGTCTGGAGTTGAGAGAACGGAGCGGACGCCAT
GGCGGCCGACATCGAGCAGGTTTTCAGGTCTTTCGTGGTCAGGTAAAATTTCCGGGAAATACAACAGGAGCTTTCCAG
Sequence Type mRNA
Unitrap ID UNI4569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91648129..91648229 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es