Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0734
Clone ID AC0734
Vector pGT0lxr
Project sanger

Sequence tag AC0734
Sequence
GTTCTACTTCTAAGAAGGGGCGATGGGAAGCTCATGAGCTGAGGCTGCTGGCCTCGGGAGGACAACAT
Sequence Type mRNA
Unitrap ID UNI4571

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96531303..96531368 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028099 (Polr3c) NP_083201 polymerase (RNA) III (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:1921664]

 
Come back to gene ENSMUSG00000028099


For any suggestions or comments, please send an email to unitrap@crg.es