Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST321840
Clone ID OST321840
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST321840
Sequence
TTTTGAGGAACATGTCCTTTGGGTTTGTTAGTGATNCGGGGCAGTTCATCCGAGAGTCTGAGCCTGAACCTNNTGTGAAG
AAATCAAAAGGATTCATGTTCTCACAAGCTATGAAGAAGTGGGTGCAAGGAAATACTGATGAGGCCCAAGAAGAGCTAGC
TTGGAAGATTGCAAAAATGATAGTGAGTGATGTTATGCAGCAGGCACACCATGATCAACCACTAGAGAAGTCTACAAAGC
TATGACTCGAAACCAGAGATAAGGAAATCTGATTTTGAAAAAATAAGAACTTTCCCCTTTGGTTGGATTCTTCAACACAG
CCGATGAAAACGGAGCACTGCATTTCTTTTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI9212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61686410..61700289 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]

 
Come back to gene ENSMUSG00000047804


For any suggestions or comments, please send an email to unitrap@crg.es