Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0126
Clone ID AB0126
Vector pGT0lxr
Project sanger

Sequence tag AB0126
Sequence
TGCTTTGGGCAGTGGTGGTGCCAGCGGTTCCGGGCCGCGAGGAAAAGGAAGTGACGGTGGTGCATCATCTTCTGGAAACG
TGTCTGGGGTTACCCCTGCCACTCCTGCAGGAGGCTCGCGCTCCTCCTCCCGGAACATAGGATCTTCAGGGCCTGAGAAA
GAAGAAGGAAAGAAGGTCCGAAGGCATGTGGGAGTCATGGAGCACCGAGGACAAGAACACTTTCTTCGAGGGACTGTATG
AG
Sequence Type mRNA
Unitrap ID UNI4572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25140157..25150679 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038002 (Cramp1l) NP_065633 Crm, cramped-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1930190]

 
Come back to gene ENSMUSG00000038002


For any suggestions or comments, please send an email to unitrap@crg.es