Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST321491
Clone ID OST321491
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST321491
Sequence
TGAGTGCCATGGCAGACAGGATGTGGAAAATGAACTTTTGGATTATGATGAAGATGAAGAGCCCCAGGCACCCCAGGAGA
GCACTCCAGCTCCCCCGAAGAAAGATGTCAAAGGATCTTATGTCTCCATCCACAGTTCTGGCTTCCGGGACTTTCTACTG
AAGCCAGAGCTCCTGAGAGCTATAGTTGACTGTGGCTTTGAGCATCCTTCAGAGGTCCAGCATGAGTGTATTCCCCAGGC
CATTCTGGGTATGGATGNCCTGTGCNAGGCCNAGTGTGGGATGGGCAAGACAGCTGNGTTTGTGCTGGCCACCCTGCAGC
AGATTGAGCCTGTCAATGGCCAGGTATCAGTCCTGGTCATGTGCCACNCGAGGGAGCTGGCCTTCCATATCAG
Sequence Type mRNA
Unitrap ID UNI21674

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86243284..86244497 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]

 
Come back to gene ENSMUSG00000005481


For any suggestions or comments, please send an email to unitrap@crg.es