Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST321195
Clone ID OST321195
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST321195
Sequence
GACTGAGGTAATTTCTCCGAAAGAAACAAAATTGATGCCTTGCATCCTGGAAGTTCATTTAGGAATCTGAAATTAGGGAC
TTCTTTAAAATTTGGACATGGCTAATCGAGGAGCAACAAGACCCAACGGGCCAAATACTGGAAATAAAATATGCCAGTTC
AAACTGGTCCTTCTAGGAGAGTCTGCATGTTGGCAAATCAAGCCTGGTTCTTCGCTTTGTGAAAGGCCAATTTCATGAAT
TTCAAGAGAGTACCATTGGGGCTGCCTTTCTAACCCAAACTGTGTGTCTTGATGACACAACAGTAAAATTTGAAATATGG
GATACAGCTGGTCAAGAACGGTATCATAGCTTAGCACCAATGTACTACCGAGGAGCACAAGCAGCCATAGTTGTGTATGA
TATCACAAATGAGGAATCCTTTGCGAGAGCAAAAAACTGGGTTAAAGAACTTCAAAGGCAAGCAAGTCCTAATATTGTGA
TAGCTTTGTCAGGAAACAAAT
Sequence Type mRNA
Unitrap ID UNI19128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53623144..53637799 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017831 (Rab5a) NM_025887 RAB5A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105926]

 
Come back to gene ENSMUSG00000017831


For any suggestions or comments, please send an email to unitrap@crg.es