Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0125
Clone ID XT0125
Vector pGT0lxf
Project sanger

Sequence tag XT0125
Sequence
TTTTTTAAAGGGTTTTTTTTTTTTTTTGGCCTCGGCCCACTTTTTTTTTTTTTTTCACGCGATTTCCGGGAACCTGTCAG
TGAAGGACATAAACAAAACAAACCGAGGCAGCATGGAGACGGGCCGCGGCCGCGTAAGCGCGGCCGGATCCAGTGCCTGA
ACCGCCTTCAGCCTCAG
Sequence Type mRNA
Unitrap ID UNI4582

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26852598..26852719 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048249 (A930001N09Rik) NM_029870 RIKEN cDNA A930001N09 gene Gene [Source:MGI Symbol;Acc:MGI:1924378]

 
Come back to gene ENSMUSG00000048249


For any suggestions or comments, please send an email to unitrap@crg.es