Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST321074
Clone ID OST321074
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST321074
Sequence
GACTGAGATACAGACCTGTCCAAAGNAAGTCTTTACACTGAAGGAGGCTCTGAAGGTGCAGCAGTCCACCCCAGCCAGCT
CCAAGGAGGAGGAGGCTCTGCGCGGCCAGGTGACAGCCCTGCAGCAGCAGATACAGGAGGAGGCCCGGGAGCATGGCCGC
TGTGGTGGCTTTATACCGCACCCATCTCCTGTATGCCATTCAGGGACAGATGGATGAGGATGTACAGTGCATTTTGAGCC
AGATTCTGCAGATGCAGCGGCTTCAGGCTCAGGGTCGCTGAGGACACAGCTCAACTGTTCAGTCTCCATCCTTCACCTCT
ACAAGCAGAAGCCACAGACACCATCTTCCCCAGCTCCCAGGGGATGAACAAGATTCAACACTCAATGGGAGACCAGCCTG
GGGCCTTATCGATGGTGGCCAGCTGACCACCCCACACTCCCTATAGTCTGTTCCTCTGATTCCCAGCACTCCCCATTTGA
TATATTGGGAACCCTGATATGCCACCTAA
Sequence Type mRNA
Unitrap ID UNI20707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81109048..81110149 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054708 (Ankrd24) NM_027480 ankyrin repeat domain 24 Gene [Source:MGI (curated);Acc:Ankrd24-001]

 
Come back to gene ENSMUSG00000054708


For any suggestions or comments, please send an email to unitrap@crg.es