Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320970
Clone ID OST320970
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320970
Sequence
GTCACTTGGCTCTGCAGATTGAAGGACAGNANTTTGACAGAGACTTGAATGCCGCTCACCANTGTCTGAAAACCATAGNG
AAGAAGTTGATCCAGTCACTTGCTAATCTCCCATCAGATGCCCACGTGGTTGCCTGCGCTTCCTTGAGACAGATCTTACA
GAATCTCCCAGATGTATGAGTACAAGAGGCAGCCAGACTACAGCTGGCCCTGCCAAGGAAACAGAATCCTTCACCTTCTA
AACAGTCAGCAGCGATGGGTGTTTATGTGGCCAAAAGAACTTGATAGTTCATGTCTATGTCTGACCAAGAGCATCTGTAG
CCTACAGCATGATAGCATGTAGTATGTATATTTTTAAAGTAGTTGTGTATATTTTTCAAGCATATTGACTTACTGTTGAC
TTTCTGAAGTATACTTCTTTGGGGAGCTAATTGGACTATATATATGTATATAT
Sequence Type mRNA
Unitrap ID UNI21691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62895465..62895917 445
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048281 (Dleu7) NM_173419 deleted in lymphocytic leukemia, 7 Gene [Source:MGI Symbol;Acc:MGI:2447771]

 
Come back to gene ENSMUSG00000048281


For any suggestions or comments, please send an email to unitrap@crg.es