Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320735
Clone ID OST320735
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320735
Sequence
GACGGACTCAGACAAGTTCTGGNGGAGATGAAAGCTTTGTATGAACAAAACCAGTCTGATGTGAATGAAGCCAAATCAGC
TGGACGAGGGGATCTGATACCAACCGTCAAATTTCGGCACTGTGCTTTGTTAAGAAATAGACGCTGCACGATAGCATACC
TGTATGACCGGTTGCTTCGGATTAGAGCACTCAGGTGGGAATATGGGAGTGTCTTGCCAAATAGTTTACGATTCCACATG
TCTGCTGAAGAAACGGAGTGGTTCAACCATTATAAAAAGTCTCTTGCTACATACATGAGGTCACCTGGGAGGAGATGAAG
GCTTGGACATCACACAAGATGTGAAGCCCCCCAAAAGCCTATATATTGAAGTNTGNGNACCTACTTNANNGCNTACATTG
NGCTACCCTNTATAAANTTAAAGGCTTACTGGCTT
Sequence Type mRNA
Unitrap ID UNI19504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150738520..150751799 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027454 (Gins1) GINS complex subunit 1 (Psf1 homolog) Gene [Source:MGI (curated);Acc:Gins1-001]

 
Come back to gene ENSMUSG00000027454


For any suggestions or comments, please send an email to unitrap@crg.es