Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320539
Clone ID OST320539
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320539
Sequence
AATAAAGACCATGCGCAAGCCCCGGTGCTCCCTGCCTGATGTCCTGGGCAGCAGCTGGGCTGGTCAGACGCCGACGTCGC
TATTCTCTGAGTGGCAGTGTTTGGAAGAAACGCACCCTGACATGGAGTATCCGGTCCTTCTCTCAGAAATCCCAGTTGAG
CCCGCAGATTGTTCGGACCCTCCNGNGCTANNCCCTGNNNGATGGGCTACTGAATNAAAGCCTTACATTCCAGGAGGTGA
ATTCTCAGTACCAGGAGCCTGACATCATTATCCACTTTGCTCGGGCCTACCACCAGGACAGTTACCCCTTTGACGGGTCT
GGTGGCACGTTGGCTCACGCCTTCTTCCGTTCCT
Sequence Type mRNA
Unitrap ID UNI17560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23776789..23777231 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023903 (Mmp25) NM_001033339 matrix metallopeptidase 25 Gene [Source:MGI Symbol;Acc:MGI:2443938]

 
Come back to gene ENSMUSG00000023903


For any suggestions or comments, please send an email to unitrap@crg.es