Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320483
Clone ID OST320483
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320483
Sequence
ACTGAGGATTTAGTCCCTATGATGACGTGCATGTCAACTTCACTCAGGAAGAATGGGCTTTGCTGGATCCTTCTCAGAAG
AGTCTCTACAAAGGTGTGATGCTAGAGACCTATAGGAATCTCACAGCTATAGGTTACATTTGGGAAGAACATACAATTGA
AGACCATTTCCAAACTTCTAGAAGTCATGGAAGGCGNTNNTNNTNTGNAACCNGATNACAANNNNCCTATGANAAAAGNT
GANCGNGNGCNNCNGNTTNTNAAAAAAACCAATANGGNNCNNTAAGCATTNNTTTCNGTCATGGATATTTACTGAATTTC
ATAAAATCATATATGTCTATGGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174888950..174889497 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078905 (OTTMUSG00000016546) NP_001079015 predicted gene, OTTMUSG00000016546 Gene [Source:MGI Symbol;Acc:MGI:3649576]

 
Come back to gene ENSMUSG00000078905


For any suggestions or comments, please send an email to unitrap@crg.es