Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320429
Clone ID OST320429
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320429
Sequence
CTACTAGGGAGTGCCCACCACCTGTGCCCTGCAGACAGGTGCTTGCTGACACCATCATGCCAAGCAGGATCCCTCTCCCT
GCGTTCTGCTGCTTNCTTCTCCCCTGGGCCTTNACCAGCTTTCACAAAGCCCTGGGGAATCCGGGGANGANANGNAGNCA
CCCCTCCCCCAGNCTGANGNNNGNTNGCNC
Sequence Type mRNA
Unitrap ID UNI21711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87828246..87828393 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004894 (Hapln2) NM_022031 hyaluronan and proteoglycan link protein 2 Gene [Source:MGI (curated);Acc:Hapln2]

 
Come back to gene ENSMUSG00000004894


For any suggestions or comments, please send an email to unitrap@crg.es