Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320336
Clone ID OST320336
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320336
Sequence
GGGCTGGCGCCAGGACAGCTTAGCAGTNTTACTCNTTAANGCTGCANAGNNTCCACCGGGAGCATTGNGAATACTNCGAT
ACCCACATNCCCAACATCTTCTCAGAAACCNGGNGATNAGAAAANGATAGGNNGATGNGTTNCGGTATTGGGGAGTCCAT
GAAGACGTACTGCAGAGGTGGACCGGCAGGTGATACCCATCATCGGGAAGTGCCTGGACGGGATAGTGAAGGCGGCCGAG
TCTATCGACCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30910949..30914500 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es