Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320305
Clone ID OST320305
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320305
Sequence
TTCATCCTTCAAGAAGAGGCTGNGGACAGCTTCTTAGAAAGTATCTTCAAGACCGAGTTTGTCAGCCTTCTGTGCAAGCG
TTTTGAAGAGGCAGCCGCGCAGGCCCCTTCCCCTCACCTTCAGTGACCT
Sequence Type mRNA
Unitrap ID UNI21717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33738623..33738750 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es