Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST320285
Clone ID OST320285
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST320285
Sequence
ACTGAGAAGAGGCCTAAGAAGAAAGAAAATGAAATTGGATGTCGAAGGTCCATGCGGTTGTTGAAAGTAGACCCTTTGGG
AGTTTCATTACCAGCATCTCCAACACAGCCAACATTAGTAGAAGAAGAAGAAAATGTAAGAAGAAATACAAATGAAGTGC
ATTTAGCTTAAGCAGAATCTGAAGAATGGTGTAAAGTATTTGAAATTATACTAGTGGATCTTTGATTTGTAAAAAAAATA
T
Sequence Type mRNA
Unitrap ID UNI16942

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121351189..121351412 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027242 (Wdr76) NM_030234 WD repeat domain 76 Gene [Source:MGI (curated);Acc:Wdr76-002]

 
Come back to gene ENSMUSG00000027242


For any suggestions or comments, please send an email to unitrap@crg.es