Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST319997
Clone ID OST319997
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST319997
Sequence
ACTGAGGTGGGGTCTTTCCTCGTTTAGTCGAAATCACTCTGAAGGGGCGCACAGTCATTGTGAAGGGCCCCAGGGGGACT
CTGCGGAGGGACTTCAATCACATCAACGTGGAGCTGAGTCTTCTTGGGAAGAA
Sequence Type mRNA
Unitrap ID UNI15414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65781988..65782105 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047215 (Rpl9) NM_011292 ribosomal protein L9 Gene [Source:MGI (curated);Acc:Rpl9-001]

 
Come back to gene ENSMUSG00000047215


For any suggestions or comments, please send an email to unitrap@crg.es