Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0170
Clone ID XR0170
Vector pGT0lxf
Project sanger

Sequence tag XR0170
Sequence
GCTCTCTGAAGCTGAGCAATCTGGAGTGTATCTTCTTGGCGTGTTCTGTGTGCAGGCTCAGACAAGCTCAGAAGTCCCGA
CATG
Sequence Type mRNA
Unitrap ID UNI3370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150277138..150277220 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068130 (Zfp442) zinc finger protein 442 Gene [Source:MGI (curated);Acc:Zfp442-001]

 
Come back to gene ENSMUSG00000068130


For any suggestions or comments, please send an email to unitrap@crg.es