Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST319429
Clone ID OST319429
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST319429
Sequence
TGGAGACGCAACAAAGATTCTGCCAAGCTAGATGCTATGAAGCGAATTGTTGGGATGATTGCGAAGGGGAAAAATGCCTC
GGAACTCTTCCCTGCTGTTGTGAAGAATGTGGCCAGTAAAAACATCGAGATCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18603

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95160770..95164748 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021686 (Ap3b1) NM_009680 adaptor-related protein complex 3, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1333879]

 
Come back to gene ENSMUSG00000021686


For any suggestions or comments, please send an email to unitrap@crg.es