Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST319295
Clone ID OST319295
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST319295
Sequence
GACTGAGAATGACTTACAAAATGAAGAAAGAATATGCCTTTTGGGCCACTGTGTGTCTGTTGCTTAGCCTTGTTCCCGAG
TTTCTTAATGCTCTGTCTGAGGAAGCTGATGACACAGATTCTGAGCTGGGGTCAATGAAACCGCTACATACATTTTGTGC
AATGAAGGCAGATGATGGTCCATGCAAAGCAATGATAAGGAGTTATTTTTTCAATATGTATACTCATCAATGTGAAGAAT
TTATATACGGGGGATGTGAAGGGAACGAGAACCGATTTGATACCCTGGAAGAGTGTAAGAAAACATGCATACCAGGTTAT
GAGAAGACAGCTGTGAAGGCAGCATCTGGAGCAGAAAGGCCAGATTTCTGCTTCTTGGAAGAGGACCCTGGACTCTGCCG
AGGTTACATGAAGAGGTATCTTTATAACAACCAGACAAAGCAGTGTGAACGATTCGTGTACGGTGGCTGCCTGGGCAACC
G
Sequence Type mRNA
Unitrap ID UNI12892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84284947..84298289 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027082 (Tfpi) NM_011576 tissue factor pathway inhibitor Gene [Source:MGI (curated);Acc:Tfpi-001]

 
Come back to gene ENSMUSG00000027082


For any suggestions or comments, please send an email to unitrap@crg.es