Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST319066
Clone ID OST319066
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST319066
Sequence
ACTGAGGCCTCGAGGAGCTGGTTCTGTCTGAGATGAACTCACCAAGCAGGACCCAGACAGGGGACAGCAGTAGTGTCTCC
TCCTTCAGCTACCGGGAGATCTTGAAGGAGAAGGAGAGTTCAGCCATCCCAGCCAGGTCTCTATCCAGCAGTCCTCAGGC
CCAGCCCCCTCGGCCAGCAGAGCTGTCAGATGAGGAAGTGGCTGAGCTGTTTCAGAGGCTGGCCGAGACTCANCAGGAAA
AATGGATGCTAGAGGAGAAGGTGAAACACCTGGAGGTGAGCAGCGCCTCTATGGCGGAAGATCTCTGCCGGAAAAGCGCC
ATCATTGAGACCTACGTCATGGACAGCCGGATTGATGTGTCTGTGGCAGCAGGCCACACANACCGAAGTGGGCTGGGCAG
TGTCCTGAGAGACCTANTGAAGCCAGGCGATGAGAACCTTCGAGAAATGAACAAGAAGCTGCAGAACATGTTGGAGGAGC
AACTCACCAAGAACATG
Sequence Type mRNA
Unitrap ID UNI21745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7391692..7396435 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031153 (Gripap1) NM_207670 GRIP1 associated protein 1 Gene [Source:MGI (curated);Acc:Gripap1-002]

 
Come back to gene ENSMUSG00000031153


For any suggestions or comments, please send an email to unitrap@crg.es