Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST318858
Clone ID OST318858
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST318858
Sequence
TGAGGCTGTGGGGTCCCTGCCTCCAACCCGTGCTGACCGGTCTGTCCAGGATCGTCAACGGAGAGGATGCTATCCCTGGC
TCCTGGCCCTGGCAGGTGTCCCTGCAGGACAGAACTGGCTTCCATTTCTGCGGGGGCTCCCTCATCAGCGAAAACTGGGT
GGTCACTGCTGCCCACTGCGGGGTCAAGACAACCGATGTGGTGGTAGCTGGAGAGTTTGATCAGGGCTCCGATGAAGAGA
ATGTCCAGGTCCTGAAAATCGCTCAGGTTTTTAAGAACCCCAAGTTCAACTCCTTCACCGTGCGTAATGACATCACCCTG
CTGAAGCTGGCCACTCCTGCCCAGTTCTCTGAGACTGTGTCTGCCGTGTGTCTGCCCACTGTTGACGATGACTTCCCTGC
TGGGACACTGTGTGCCACCACTGGCTGGGGCAAGACCAAATACAATGCCCTCAAGACCCCTGACAAGCTGCAGCAGGCTG
CCCTGCCCATCGTGTCCGAGG
Sequence Type mRNA
Unitrap ID UNI20112

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114211081..114213502 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031957 (Ctrb1) NM_025583 chymotrypsinogen B1 Gene [Source:MGI Symbol;Acc:MGI:88559]

 
Come back to gene ENSMUSG00000031957


For any suggestions or comments, please send an email to unitrap@crg.es